검색
검색 팝업 닫기

Ex) Article Title, Author, Keywords

Article

Split Viewer

연구논문(Research Paper)

2023; 34(2): 45-52

Published online April 25, 2023 https://doi.org/10.3807/KJOP.2023.34.2.045

Copyright © Optical Society of Korea.

Photobiomodulation Mediated by Red and Infrared Light: A Study of Its Effectiveness on Corneal Epithelial Cells and Wound Healing

Sun Hee Ahn1, Jae Sung Ahn1, Byeongil Lee2

적색 및 적외선 빛을 이용한 Photobiomodulation: 각막상피세포에 대한 효과와 상처 치유에 관한 연구

안선희1ㆍ안재성1ㆍ이병일2†

1Medical & Biophotonics Research Center, Korea Photonics Technology Institute, Gwangju 61007, Korea
2Department of Smart Healthcare, Pukyoung National University, Busan 48513, Korea

1한국광기술원, 광의료바이오 연구센터 ㉾ 61007 광주광역시 북구 첨단벤처로 108번길 9
2국립부경대학교, 스마트 헬스케어 학부 ㉾ 48513 부산광역시 남구 용소로 45

Correspondence to:bilee@pknu.ac.kr, ORCID: 0000-0002-1574-7145

Received: March 6, 2023; Revised: March 10, 2023; Accepted: March 15, 2023

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

In this study, we have investigated the effect of photobiomodulation (PBM) on corneal wound healing, using a low-power light-emitting diode (LED) at different wavelengths. We found that LEDs with wavelengths ranging from 623 to 940 nm had no significant cytotoxic effects on corneal epithelial cells. The effect of PBM on promoting cell migration was analyzed by scratch assay, and it was found that PBM at 623 nm significantly increased cell migration and promoted wound healing. Furthermore, the expression of genes related to cell migration and wound healing was analyzed, and it was found that PBM at 623 nm upregulated the expression of the genes FGF-1 and MMP2, which are known to promote cell proliferation and extracellular matrix degradation. These findings suggest that PBM with low-powered light at specific wavelengths, particularly 623 nm, could be utilized to treat corneal injury.

Keywords: Corneal epithelial cell, Low-level light therapy, Photobiomodulation, Wound healing

OCIS codes: (170.1530) Cell analysis; (350.5130) Photochemistry

각막 상피는 눈의 가장 바깥쪽 층으로, 각막을 보호하는 장벽의 기능을 하며 지속적으로 세포를 재생하여 표면을 유지한다. 각막 상피 조직은 물리적 자극에 의해 쉽게 벗겨질 수 있고 화학 물질이나 강한 자외선에 노출이 지속되면 손상된다[1,2]. 이는 통증, 부종, 눈부심, 이물감, 충혈 등을 유발하고 상처 부위의 세균, 곰팡이균 감염으로 인한 각막염, 각막궤양과 같은 합병증을 발생시킨다. 또한, 외상의 깊이가 깊어 상피층을 넘어 기질층까지 손상되면 각막혼탁으로 인한 시력저하가 생길 수 있다.

각막 상피의 상처가 치유되는 동안, epidermal growth factor (EGF)는 상피 세포 및 기질 섬유모세포에서 핵산 합성을 촉진할 뿐만 아니라 피브로넥틴(fibronectin) 생성을 자극하여 증식과 이동을 매개한다[3,4]. 손상에 대한 반응으로 IL-1과 TNF-α와 같은 염증성 사이토카인이 방출되고 hepatocyte growth factor (HGF), keratinocyte growth factor (KGF)와 같은 성장인자를 생성한다[4,5]. Insulin-like growth factor (IGF)와 transforming growth factor-beta (TGF-β)는 기질각화세포 및 상피세포의 분화와 성장을 조절하고 다양한 신호 전달 경로의 상호작용을 통해 치유 과정을 거친다[6].

Photobiomodulation (PBM)은 특정 파장대의 가시광선 및 근적외선 스펙트럼을 기반으로 광원을 적절한 강도로 조사하여 세포의 기능을 자극, 치유 및 재생시키는 광선 요법의 한 형태로 정의된다. 적색광 및 근적외선은 세포 내 미토콘드리아에서 작용하는 cytochrome c oxidase (CCO)와 같은 광감작성 분자에 흡수되어 adenosine triphosphate (ATP) 합성을 증가시키고 세포의 대사활동을 촉진시킨다[7,8]. PBM 치료법은 면역 조절과 상처 치유를 촉진하고 통증 및 염증을 완화하는 효과가 있는 것으로 보고되었다[9,10].

최근 안과에서는 안구건조증, 마이봄샘기능장애(meibomian gland dysfunction, MGD)의 새로운 치료방법으로 intensive pulsed laser (IPL) 사용이 증가하고 있다[11,12]. IPL은 막힌 기름샘과 눈물샘의 분비를 원활하게 하고, 눈꺼풀 혈관의 헤모글로빈에 흡수되어 혈관 수축과 염증을 감소시킴으로써 근본적인 치료에 도움이 된다. 최근 연구에 따르면, 저출력 광원의 PBM 효과를 이용한 치료법도 세포증식(cell proliferation) 및 세포이동(cell migration) 촉진, 신경 재생 촉진, 과민성 감소 등 다양한 메커니즘을 통해 각막 상처 치유를 촉진할 수 있는 것으로 나타났다[13,14]. 그러나 각막 상처 치유를 위한 PBM 치료의 최적 파라미터와 메커니즘을 이해하기 위해서는 더 많은 연구가 필요하다.

본 연구에서는 자연치유보다 광치료가 더 빠르게 각막상피 손상을 회복할 수 있다는 가정 하에 PBM의 각막상피 상처치유 효과에 대해 확인하였다. 본 연구에서는 적색 및 적외선 영역의 다양한 파장의 LED 광원을 사용하여 각막상피세포에서 세포이동 촉진효과가 가장 우수한 광원파장을 도출하고, 해당 실험군에 대해 광조사에 의해 발현되는 유전자를 분석하여 PBM에 의한 각막상피 상처치유의 메커니즘을 분석하였다.

2.1. 세포 배양

본 연구는 보건복지부 지정 공용기관생명윤리위원회 심의를 거치고 연구윤리승인을 받아 시행되었다(승인번호: P01-202303-02-001). Human corneal epithelial (HCE) 세포는 American Type Culture Collection (ATCC, VA, USA)으로부터 분양받았다. 세포의 배양 배지는 corneal epithelial cell basal medium에 corneal epithelial cell growth kit (apo-transferrin, final concentration 5 µg/mL; epinephrine, final concentration 1.0 µM; Extract P, final concentration 0.4%; hydrocortisone hemisuccinate, final concentration 100 ng/mL; L-glutamine, final concentration 6 mM; Rh insulin, final concentration 5 µg/mL; CE growth factor, final concentration 0.2%)와 1% penicillin/streptomycin (100 U/mL penicillin, 100 mg/mL streptomycin), 그리고 항생제로 penicillin-streptomycin-amphotericin B solution (final concentration penicillin: 10 units/mL, streptomycin: 10 µg/mL, amphotericin B: 25 ng/mL)을 추가하여 complete medium으로 만들어 사용하였으며, 세포는 37 ℃, 5% CO2 습윤 배양기에서 배양하였다. 모든 세포들은 ATCC에서 제시한 프로토콜에 따라 계대배양을 진행하였으며, 계대배양 시에는 primary 세포용 trypsin-EDTA (0.05% trypsin; 0.02% EDTA)를 처리하여 탈착시킨 후 trypsin neutralizing solution을 추가하여 세포의 손상을 막고, 부유 상태의 세포들을 800 rpm에서 20 ℃로 5분 동안 원심 분리시켜 수확하였다. 상기의 세포 배지 및 첨가물의 시약들은 모두 ATCC에서 구매하여 사용하였다. 세포의 배양은 실험목적에 따라 24-well plate 또는 6-well plate에 각각 5 × 104 cells/well, 2.5 × 105 cells/mL의 농도로 분주하였다.

2.2. 광원

실험에 사용된 LED (Solis® high-power LEDs for microscopy; Thorlabs Inc., NJ, USA)는 중심 파장이 각각 λ = 623, 660, 740, 850, 940 nm로 지그에 장착하여 24-well plate에 조사되었다. 각 실험조건마다 24-well plate의 상부에 제작한 마스크를 고정하여, 단일 well에만 LED가 조사되도록 하였다. 24-well plate 하부에는 포토다이오드 센서(PD300-MS; Ophir Optronics Solutions, Jerusalem, Israel)를 설치하여 마스크를 통과한 광량을 측정하고, 세포 시료에 조사하는 모든 LED 모듈의 광량을 일정하게 하였다. 실험장치는 이산화탄소 세포배양기(Forma 371; Thermo Fisher Scientific, MA, USA) 내에 설치하여 실험 중 일정한 환경이 유지되도록 하였다[그림 1(a)]. LED 조명 모듈의 출력 중심파장, 출력 스펙트럼은 스펙트로미터(USB4000; OceanInsight, FL, USA)를 사용하여 측정하였다[그림 1(b)]. 모든 실험과정에서 LED의 총 에너지 양은 3–10 J/cm2 범위에서 조사하였다.

Figure 1.Representative picture of the experimental setup and emission spectra of light-emitting diodes (LEDs). (a) LEDs were irradiated to the 24-well plate from the top and a single-well-shaped mask was fixed on the top surface of the well plate to prevent LED light from being irradiated to adjacent wells. The power of LED light transmitted through the mask was measured with a photodiode sensor to derive the amount of light energy irradiated to the sample. (b) Normalized spectra of LED light sources.

2.3. 세포 생존률 측정

세포 생존률은 EZ-Cytox kit (DaeilLab, Seoul, Korea)를 사용하여 분석하였다. 간단하게는, 살아있는 세포의 탈수소 효소(dehydrogenase)로 water soluble tetrazolium salt (WST)를 반응시켜, 오렌지 색의 수용성 포르마잔(formazan)이 생성되는 양을 흡광도로 측정하여 세포의 생존률을 측정하였다. 우선, HCE 세포를 24-well plate에(5 × 104 cells/well) 시딩(seeding)하고 24시간 동안 배양시켜 완전히 부착된 것을 확인한 다음, HCE 세포에 적색(λ = 623, 660 nm) 및 적외선 LED (λ = 740, 850, 940 nm)를 5 J/cm2, 10 J/cm2의 에너지로 조사하고, 24시간 동안 37 ℃, 5% CO2 습윤 배양기에서 추가로 배양하였다. 다음날, 배양액에 각 well 당 EZ-Cytox 용액을 100 µL씩 첨가한 뒤, 4시간 동안 추가로 배양(incubation)하였다. 흡광도를 측정하기 전, 1분 정도 부드럽게 흔든 후 microplate reader (Epoch; BioTek, VT, USA)를 이용하여 450 nm에서 흡광도를 측정하였다. 세포 생존률은 광 조사를 하지 않은 그룹의 흡광도 수치를 기준으로 한 상대 비율 값으로 계산하였다.

2.4. 세포이동 측정

HCE 세포를 6-well plate에 2.5 × 105 cells로 분주하여 24시간 동안 배양한 다음, 다음날 멸균된 200 μl 피펫 팁을 수직으로 반듯이 세워 단일층으로 자란 세포면 중앙에 한 줄로 균일하게 세로 방향으로 긁어낸다. 긁어내는 과정에서 분리된 세포조각(cell debris)은 배지 제거를 통해 조심스럽게 제거하고, 불필요하게 떨어진 나머지 세포들 또한 인산완충생리식염수(phosphate-buffered saline)를 이용하여 세척한 뒤, 배양배지로 교환한다. 이때, 스크래치(scratch)된 부위의 세포를 Olympus CKX53 현미경(Olympus, Tokyo, Japan)을 통해 40× 배율에서 관찰하고 카메라를 이용하여 사진 촬영한다. 이후, 스크래치된 세포는 2.2절에서 제시된 바와 같은 광 조사 조건에 노출시킨 후 24시간 동안 추가 배양(37 °C, 5% CO2)하고, 세포이동이 진행된 이미지를 상기와 같은 조건으로 사진으로 촬영한다.

2.5. Real-time PCR

각 파장별 광 조사가 세포이동의 어떠한 분자 발현에 영향을 미치는지를 조사하고자, real-time polymerase chain reaction (PCR)을 수행하여 관련 유전자의 발현을 분석하였다. 6-well에 배양된 세포에 상기의 세포이동 실험을 수행한 후, RNeasy kit (Qiagen, MD, USA)를 이용하여 mRNA를 분리하였다. 분리된 mRNA 1 µg을 PrimeScriptTM RT Reagent Kit (Takara Biotechnology, Tokyo, Japan)와 제조사에서 제시한 프로토콜에 따라 cDNA를 합성하였다. 합성된 cDNA를 대상으로 Power SYBR Green PCR Master Mix (Applied Biosystems, CA, USA) 시약과 혼합하여 QuantStudio 3 real-time PCR system (Applied Biosystems, CA, USA) 기기를 이용하여 real-time PCR을 수행하였다. 분석 결과는 2∆∆CT method로 상대적인 발현양으로 계산되었으며, 가사유전자(housekeeping gene)로서의 glyceraldehyde 3-phosphate dehydrogenase (GAPDH)의 발현을 대조군으로 사용하여 정규화(normalization)를 수행하였다. 타깃 유전자에 대한 프라이머(primer) 정보는 표 1에 나타냈다.

Table 1 Primer name, sequence, and target gene used in the present study

NameSequence (5' → 3')Target Gene
hGAPDH_F
hGAPDH_R
accccttcattgacctcaac
cttgacggtgccatggaatt
GAPDH
hIL-1α_F
hIL-1α_R
ggtagtagcaaccaacggga
cttcatcttgggcagtcaca
IL-1α
hTGF-β1_F
hTGF-β1_R
gggactatccacctgcaaga
cggagctctgatgtgttgac
TGF-β
hIGF-2_F
hIGF-2_R
caccctccagttcgtctgtg
ttgggtgggtagagcaatca
IGF-2
hFGF-1_F
hFGF-1_R
agcccacagagcctgaattt
caggaaggacaaaagggagc
FGF-1
hCOL3A1_F
hCOL3A1_R
hMMP-2_F
hMMP-2_R
cctccaactgctcctactcg
tcgaagcctctgtgtccttt
gctggagaaccaaagtctga
cagtgccctcttgagacagt
Col3A1
MMP2


2.6. 통계 처리

본 실험의 데이터는 GraphPad Prism 5 (GraphPad, CA, USA)를 사용하여 분석되었으며, 실험결과는 독립적인 3반복 실험의 평균 ± 표준편차로 나타냈다. 그룹 간의 차이는 unpaired two tailed t-test 방법을 이용하여 유의성을 분석하였으며, P < 0.05이 통계적 유의성을 가지는 것으로 정의되었다.

3.1. 세포 생존률 평가

HCE 세포에 대한 적색 및 근적외선 LED의 세포 독성과 실험에 사용될 총 에너지량을 결정하기 위해 MTT assay를 수행하였다. HCE 세포에 적색(λ = 623, 660 nm) 및 적외선 LED (λ = 740, 850, 940 nm)를 5 J/cm2, 10 J/cm2의 에너지로 조사한 결과, 모든 군에서 독성이 나타나지 않아 세포 생존율에 큰 영향을 나타내지 않음을 확인하였다(그림 2). 이후, 모든 실험은 세포 독성이 나타나지 않은 광 조사 조건에서 진행하였다. 광조사가 실시된 그룹들 전반적으로 대조군(비 광조사군)에 비해 세포 생존율(cell viability)이 높아진 것이 관찰되었으며, 이러한 경향은 세포 증식에 적외선을 포함한 근적외선 파장 광조사가 미친 영향이라고 생각된다[13].

Figure 2.Cell viability measurement by red light-emitting diode (LED) and infrared LED irradiation with fluences of (a) 5 J/cm2 and (b) 10 J/cm2. All groups showed no cytotoxicity compared to the control group. Every assay was performed 3 times and the results are expressed as mean ± standard deviation (SD). An unpaired two tailed t-test was used for comparisons between two means.

3.2. 세포이동

각 파장의 광조사에 따른 HCE 세포의 상처 치유(wound healing) 영향을 조사하고자, 단일층(monolayer)으로 준비된 세포에 스크래치를 만들어 그 사이를 세포가 이동(migration)하면서 채워 나가는 효과를 관찰하였다. 세포의 스크래치는 모두 균일하게 형성하였으며[그림 3(a), 0 h], 각 파장 별로 단위면적당 10 J/cm2의 광 조사 후 세포이동을 관찰한 결과 그림 3(a) (48 h)에서 보이듯 623 nm의 광 조사 시 스크래치 간격 사이로 세포이동이 촉진됨으로 인해 그 폭이 대조군에 비해 더 좁아진 것을 확인할 수 있었다. 623 nm 파장의 세포이동에 대한 영향을 추가로 확인하기 위해서 광 조사를 에너지 별로(3 J/cm2, 5 J/cm2, 10 J/cm2) 실시하고 경과시간 별로(24 h, 48 h) 분석한 결과, 그림 3(b)와 같이 623 nm 광조사 그룹의 세포이동 효과가 대조군인 비조사군에 비해 증가하는 것이 관찰되었으며, 이를 상처 치유 면적으로 계산하여 본 결과 그림 3(c)에서 보이듯 623 nm의 3 J/cm2 조사군에서 가장 높은 상처 치유 효과를 관찰할 수 있었다.

Figure 3.Images of cell migration assay of human corneal epithelial (HCE) cells. HCE cells were inoculated into 6 wells at 2.5 × 105 cells per well. The next day, cell monolayers were scratched using a sterile 200 μL pipette tip followed by the indicated LED irradiation. (a) Scratched cells were exposed to 623, 660, 740, 850, and 940 nm LED light with an intensity of 33.3 mW/cm2 and total energy of 10 J/cm2. (b) Scratched cells were exposed to 623 nm LED light with an intensity of 0, 3, 5, and 10 J/cm2. Cell migration was observed using an inverted microscope (Olympus CKX53; Olympus) and a digital camera at 0, 24, and 48 hours after scratching. (c) Cell wound area at 24 and 48 hours after wounding [(healing area/wounding area) × 100%].

3.3. Real-time PCR

HCE 세포의 세포이동에 있어 623 nm의 LED가 어떠한 분자 발현에 영향을 미치는지를 분석하고자, 세포이동에 관련된 유전자들의 발현을 real-time PCR을 수행하여 분석하였다. IL-1α, TGF-β, IGF2, fibroblast growth factor 1 (FGF-1), Col3A1, matrix metalloproteinase-2 (MMP2) 유전자의 발현을 대조군인 비조사군과 비교한 결과, FGF-1과 MMP2유전자의 발현이 유의적으로 증가함을 관찰하였으며, IGF-2유전자의 경우 통계적으로 유의적이진 않지만, 대조군에 비해 광조사군에서 증가하는 경향을 확인할 수 있었다(그림 4).

Figure 4.Effect of 623 nm light-emitting diode (LED) irradiation on the expression of migration-related genes in human corneal epithelial (HCE) cells. The expression of the target gene was analyzed by real-time polymerase chain reaction (PCR) in HCE cells. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the endogenous control gene for the normalization of mRNA expression. Relative expression of (a) IL-1a, (b) TGF-b, (c) IGF-2, (d) FGF-1, (e) Col2A1, and (f) MMP-2. The data presented are the mean ± standard deviation (SD) of three independent experiments. P < 0.05 compared with the control (non-irradiation group).

FGF-1 유전자는 산성 섬유아세포 성장 인자로서, 사람 또는 소의 각막 내피세포의 상처 치유를 촉진시키는 역할을 하는 것으로 알려져 있다[15,16]. 본 연구에서 623 nm 광 조사 시, 세포이동이 촉진되는 결과를 관찰할 수 있었으며 이때 FGF-1의 발현이 대조군(1.0 ± 0.16)에 비해 광조사군(1.59 ± 0.25)에서 50% 이상 증가됨을 확인하였다(P = 0.02). MMP2 유전자는 세포 외 기질 분해 기전에 중요한 기능을 하는 유전자로서, MMP2의 발현이 각막 상처치유 초기단계에서 기질 회복(stromal repair)에 역할을 하는 것으로 알려져 있으며[17], 상처 치유 중 눈물 및 각막 조직, 안구 건조증과 같은 안구 표면 질환 및 원추 각막과 같은 기질 장애에 존재하는 것으로 보고되었다[18]. 본 연구결과에서도 이와 비슷하게 세포이동이 촉진되는 것이 확인된 광조사군에서 MMP2의 발현이 대조군에 비해 유의적으로 증가(1.0 ± 0.44 vs. 1.88 ± 0.23, P = 0.04)함을 확인하였다. 뿐만 아니라, IGF-2 유전자의 경우 insulin-like growth factor 2 유전자로서 쥐(rat)의 각막 내피세포의 상처유발 시 세포의 성장을 촉진하는 것으로 알려져 있으며[19], 토끼의 각막 상피세포의 이동 또한 증가하는 것으로 보고된 바 있다[20]. 본 연구결과에서 IGF-2의 발현은, 비록 통계적으로 유의성이 드러나지 않았지만, 대조군에 비해 광조사군에서 증가하는 양상을 관찰할 수 있었다(1.0 ± 0.22 vs. 9.28 ± 6.65, P < 0.05).

이 외에 세포손상 및 사멸과 관련된 유전자인 IL-1α, 정상적인 눈물에 존재한다고 알려진 TGF-β, 콜라겐의 단량체 유형으로 일반적으로 조직 상처치유와 상관관계가 있다고 알려진 Col3A1의 발현은 광 조사와 유의미한 상관관계가 없음을 관찰하였다. 따라서, HCE 세포에서 623 nm 광조사에 따른 세포이동은 FGF-1, MMP2 두 유전자에 의한 것으로 짐작된다.

본 연구에서는 각막상피세포의 상처 치유에 광조사가 미치는 영향을 알아보기 위해 적색(λ = 623, 660 nm) 및 적외선 LED (λ = 740, 850, 940 nm)를 사용하여 세포 레벨에서의 PBM 효과를 분석하였다. LED 광조사에 따른 세포독성이 나타나지 않음을 확인하고, 각 파장별로 LED 광원을 각막상피세포에 조사하여 세포이동 결과를 분석한 결과 623 nm LED 광조사군에서 가장 세포이동이 촉진됨을 확인하였다. 623 nm LED 광조사군에 대해 real-time PCR 분석 결과, 상처치유를 촉진하는 FGF-1과 MMP2의 유전자 발현이 대조군에 비해 50% 이상 증가함을 확인하였으며, IGF-2 유전자의 경우 비록 통계적으로 유의성이 드러나지 않았지만, 대조군에 비해 증가하는 경향을 관찰할 수 있었다. 이러한 연구결과로부터 623 nm LED의 각막상피세포에 대한 PBM 효과로서 세포이동이 촉진되고 결과적으로 각막상피세포의 상처치유 개선에 활용할 수 있는 가능성을 확인하였다. 본 연구 결과는 향후 각막 상피 세포에 대한 물리적 또는 화학적 손상으로 인한 상처 치유나 안과 수술 후 빠른 회복을 위한 수단으로 적색광에 의한 PBM 효과를 이용하는 광치료기기를 개발하는 데에 활용할 수 있을 것으로 기대한다.

저자들은 이진경, 김홍빈 연구원의 세포실험 지원에 대해 감사를 표한다.

이 논문은 2021학년도 부경대학교의 지원을 받아 수행된 연구임(202126870001).

저자들은 본 논문과 관련된 어떠한 이해충돌 사항도 없었음을 밝힌다.

본 연구의 결과 분석 및 생성된 데이터는 모두 본 논문 내 명시되어 있으며 공공의 이용이 가능하다. 데이터에 접근하거나 사용하고자 하는 이는 저자에게 타당한 이유를 밝히고 허가를 득해 사용 가능하다.

  1. N. C. Delic, J. G. Lyons, N. D. Girolamo, and G. M. Halliday, “Damaging effects of ultraviolet radiation on the cornea,” Photochem. Photobiol. 93, 920-929 (2017).
    Pubmed CrossRef
  2. M. D. Wagoner, “Chemical injuries of the eye: Current concepts in pathophysiology and therapy,” Surv. Ophthalmol. 41, 275-313 (1997).
    Pubmed CrossRef
  3. K. Watanabe, S. Nakagawa, and T. Nishida, “Stimulatory effects of fibronectin and EGF on migration of corneal epithelial cells,” Investig. Ophthalmol. Vis. Sci. 28, 205-211 (1987).
  4. S. E. Wilson, L. Chen, R. R. Mohan, Q. Liang, and J. Liu, “Expression of HGF, KGF, EGF and receptor messenger RNAs following corneal epithelial wounding,” Exp. Eye Res. 68, 377-397 (1999).
    Pubmed CrossRef
  5. X. Wang, S. Zhang, M. Dong, Y. Li, Q. Zhou, and L. Yang, “The proinflammatory cytokines IL‐1β and TNF‐α modulate corneal epithelial wound healing through p16Ink4a suppressing STAT3 activity,” J. Cell. Physiol. 235, 10081-10093 (2020).
    Pubmed CrossRef
  6. J. Imanishi, K. Kamiyama, I. Iguchi, M. Kita, C. Sotozono, and S. Kinoshita, “Growth factors: importance in wound healing and maintenance of transparency of the cornea,” Prog. Retin. Eye Res. 19, 113-129 (2000).
    Pubmed CrossRef
  7. L. F. de Freitas and M. R. Hamblin, “Proposed mechanisms of photobiomodulation or low-level light therapy,” IEEE J. Sel. Top. Quantum Electron. 22, 348-364 (2016).
    Pubmed KoreaMed CrossRef
  8. Y.-Y. Huang, A. C.-H. Chen, J. D. Carroll, and M. R. Hamblin, “Biphasic dose response in low level light therapy,” Dose-response 7, 358-383 (2009).
    Pubmed KoreaMed CrossRef
  9. R. M. da S. Campos, A. R. Dâmaso, D. C. L. Masquio, A. E. Aquino Jr., M. Sene-Fiorese, F. O. Duarte, L. Tock, N. A. Parizotto, and V. S. Bagnato, “Low-level laser therapy (LLLT) associated with aerobic plus resistance training to improve inflammatory biomarkers in obese adults,” Lasers Med. Sci. 30, 1553-1563 (2015).
    Pubmed CrossRef
  10. D. P. Kuffler, “Photobiomodulation in promoting wound healing: A review,” Regen. Med. 11, 107-122 (2016).
    Pubmed CrossRef
  11. B. Tashbayev, M. Yazdani, R. Arita, F. Fineide, and T. P. Utheim, “Intense pulsed light treatment in meibomian gland dysfunction: A concise review,” Ocular Surf. 18, 583-594 (2020).
    Pubmed CrossRef
  12. S. Yan and Y. Wu, “Efficacy and safety of intense pulsed light therapy for dry eye caused by meibomian gland dysfunction: A randomised trial,” Ann. Palliat. Med. 10, 7857-7865 (2021).
    Pubmed CrossRef
  13. C. Núñez-Álvarez and N. N. Osborne, “Enhancement of corneal epithelium cell survival, proliferation and migration by red light: Relevance to corneal wound healing,” Exp. Eye Res. 180, 231-241 (2019).
    Pubmed CrossRef
  14. Y.-H. Rhee, K. J. Cho, J.-C. Ahn, and P.-S. Chung, “Effect of photobiomodulation on wound healing of the corneal epithelium through Rho-GTPase,” Med. Lasers 6, 67-76 (2017).
    CrossRef
  15. A. Thalmann-Goetsch, K. Engelmann, and J. Bednarz, “Comparative study on the effects of different growth factors on migration of bovine corneal endothelial cells during wound healing,” Acta Ophthalmol. Scand. 75, 490-495 (1997).
    Pubmed CrossRef
  16. D. Eveleth, S. Pizzuto, J. Weant, J. Jenkins-Eveleth, and R. A. Bradshaw, “Proliferation of human corneal endothelia in organ culture stimulated by wounding and the engineered human fibroblast growth factor 1 derivative TTHX1114,” J. Ocul. Pharmacol. Ther. 36, 686-696 (2020).
    Pubmed KoreaMed CrossRef
  17. B. Mulholland, S. J. Tuft, and P. T. Khaw, “Matrix metalloproteinase distribution during early corneal wound healing,” Eye 19, 584-588 (2005).
    Pubmed CrossRef
  18. M. P. Caley, V. L. Martins, and E. A. O'Toole, “Metalloproteinases and wound healing,” Adv. Wound Care 4, 225-234 (2015).
    Pubmed KoreaMed CrossRef
  19. S. R. Gordon, D. R. Reaume, and T. R. Perkins, “Insulin and IGF-2 support rat corneal endothelial cell growth and wound repair in the organ cultured tissue,” Growth Factors 38, 269-281 (2020).
    Pubmed CrossRef
  20. M. Nakamura, T. I. Chikama, and T. Nishida, “Characterization of insulin-like growth factor-1 receptors in rabbit corneal epithelial cells,” Exp. Eye Res. 70, 199-204 (2000).
    Pubmed CrossRef

Article

연구논문(Research Paper)

2023; 34(2): 45-52

Published online April 25, 2023 https://doi.org/10.3807/KJOP.2023.34.2.045

Copyright © Optical Society of Korea.

Photobiomodulation Mediated by Red and Infrared Light: A Study of Its Effectiveness on Corneal Epithelial Cells and Wound Healing

Sun Hee Ahn1, Jae Sung Ahn1, Byeongil Lee2

1Medical & Biophotonics Research Center, Korea Photonics Technology Institute, Gwangju 61007, Korea
2Department of Smart Healthcare, Pukyoung National University, Busan 48513, Korea

Correspondence to:bilee@pknu.ac.kr, ORCID: 0000-0002-1574-7145

Received: March 6, 2023; Revised: March 10, 2023; Accepted: March 15, 2023

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

In this study, we have investigated the effect of photobiomodulation (PBM) on corneal wound healing, using a low-power light-emitting diode (LED) at different wavelengths. We found that LEDs with wavelengths ranging from 623 to 940 nm had no significant cytotoxic effects on corneal epithelial cells. The effect of PBM on promoting cell migration was analyzed by scratch assay, and it was found that PBM at 623 nm significantly increased cell migration and promoted wound healing. Furthermore, the expression of genes related to cell migration and wound healing was analyzed, and it was found that PBM at 623 nm upregulated the expression of the genes FGF-1 and MMP2, which are known to promote cell proliferation and extracellular matrix degradation. These findings suggest that PBM with low-powered light at specific wavelengths, particularly 623 nm, could be utilized to treat corneal injury.

Keywords: Corneal epithelial cell, Low-level light therapy, Photobiomodulation, Wound healing

I. 서 론

각막 상피는 눈의 가장 바깥쪽 층으로, 각막을 보호하는 장벽의 기능을 하며 지속적으로 세포를 재생하여 표면을 유지한다. 각막 상피 조직은 물리적 자극에 의해 쉽게 벗겨질 수 있고 화학 물질이나 강한 자외선에 노출이 지속되면 손상된다[1,2]. 이는 통증, 부종, 눈부심, 이물감, 충혈 등을 유발하고 상처 부위의 세균, 곰팡이균 감염으로 인한 각막염, 각막궤양과 같은 합병증을 발생시킨다. 또한, 외상의 깊이가 깊어 상피층을 넘어 기질층까지 손상되면 각막혼탁으로 인한 시력저하가 생길 수 있다.

각막 상피의 상처가 치유되는 동안, epidermal growth factor (EGF)는 상피 세포 및 기질 섬유모세포에서 핵산 합성을 촉진할 뿐만 아니라 피브로넥틴(fibronectin) 생성을 자극하여 증식과 이동을 매개한다[3,4]. 손상에 대한 반응으로 IL-1과 TNF-α와 같은 염증성 사이토카인이 방출되고 hepatocyte growth factor (HGF), keratinocyte growth factor (KGF)와 같은 성장인자를 생성한다[4,5]. Insulin-like growth factor (IGF)와 transforming growth factor-beta (TGF-β)는 기질각화세포 및 상피세포의 분화와 성장을 조절하고 다양한 신호 전달 경로의 상호작용을 통해 치유 과정을 거친다[6].

Photobiomodulation (PBM)은 특정 파장대의 가시광선 및 근적외선 스펙트럼을 기반으로 광원을 적절한 강도로 조사하여 세포의 기능을 자극, 치유 및 재생시키는 광선 요법의 한 형태로 정의된다. 적색광 및 근적외선은 세포 내 미토콘드리아에서 작용하는 cytochrome c oxidase (CCO)와 같은 광감작성 분자에 흡수되어 adenosine triphosphate (ATP) 합성을 증가시키고 세포의 대사활동을 촉진시킨다[7,8]. PBM 치료법은 면역 조절과 상처 치유를 촉진하고 통증 및 염증을 완화하는 효과가 있는 것으로 보고되었다[9,10].

최근 안과에서는 안구건조증, 마이봄샘기능장애(meibomian gland dysfunction, MGD)의 새로운 치료방법으로 intensive pulsed laser (IPL) 사용이 증가하고 있다[11,12]. IPL은 막힌 기름샘과 눈물샘의 분비를 원활하게 하고, 눈꺼풀 혈관의 헤모글로빈에 흡수되어 혈관 수축과 염증을 감소시킴으로써 근본적인 치료에 도움이 된다. 최근 연구에 따르면, 저출력 광원의 PBM 효과를 이용한 치료법도 세포증식(cell proliferation) 및 세포이동(cell migration) 촉진, 신경 재생 촉진, 과민성 감소 등 다양한 메커니즘을 통해 각막 상처 치유를 촉진할 수 있는 것으로 나타났다[13,14]. 그러나 각막 상처 치유를 위한 PBM 치료의 최적 파라미터와 메커니즘을 이해하기 위해서는 더 많은 연구가 필요하다.

본 연구에서는 자연치유보다 광치료가 더 빠르게 각막상피 손상을 회복할 수 있다는 가정 하에 PBM의 각막상피 상처치유 효과에 대해 확인하였다. 본 연구에서는 적색 및 적외선 영역의 다양한 파장의 LED 광원을 사용하여 각막상피세포에서 세포이동 촉진효과가 가장 우수한 광원파장을 도출하고, 해당 실험군에 대해 광조사에 의해 발현되는 유전자를 분석하여 PBM에 의한 각막상피 상처치유의 메커니즘을 분석하였다.

II. 실험 방법

2.1. 세포 배양

본 연구는 보건복지부 지정 공용기관생명윤리위원회 심의를 거치고 연구윤리승인을 받아 시행되었다(승인번호: P01-202303-02-001). Human corneal epithelial (HCE) 세포는 American Type Culture Collection (ATCC, VA, USA)으로부터 분양받았다. 세포의 배양 배지는 corneal epithelial cell basal medium에 corneal epithelial cell growth kit (apo-transferrin, final concentration 5 µg/mL; epinephrine, final concentration 1.0 µM; Extract P, final concentration 0.4%; hydrocortisone hemisuccinate, final concentration 100 ng/mL; L-glutamine, final concentration 6 mM; Rh insulin, final concentration 5 µg/mL; CE growth factor, final concentration 0.2%)와 1% penicillin/streptomycin (100 U/mL penicillin, 100 mg/mL streptomycin), 그리고 항생제로 penicillin-streptomycin-amphotericin B solution (final concentration penicillin: 10 units/mL, streptomycin: 10 µg/mL, amphotericin B: 25 ng/mL)을 추가하여 complete medium으로 만들어 사용하였으며, 세포는 37 ℃, 5% CO2 습윤 배양기에서 배양하였다. 모든 세포들은 ATCC에서 제시한 프로토콜에 따라 계대배양을 진행하였으며, 계대배양 시에는 primary 세포용 trypsin-EDTA (0.05% trypsin; 0.02% EDTA)를 처리하여 탈착시킨 후 trypsin neutralizing solution을 추가하여 세포의 손상을 막고, 부유 상태의 세포들을 800 rpm에서 20 ℃로 5분 동안 원심 분리시켜 수확하였다. 상기의 세포 배지 및 첨가물의 시약들은 모두 ATCC에서 구매하여 사용하였다. 세포의 배양은 실험목적에 따라 24-well plate 또는 6-well plate에 각각 5 × 104 cells/well, 2.5 × 105 cells/mL의 농도로 분주하였다.

2.2. 광원

실험에 사용된 LED (Solis® high-power LEDs for microscopy; Thorlabs Inc., NJ, USA)는 중심 파장이 각각 λ = 623, 660, 740, 850, 940 nm로 지그에 장착하여 24-well plate에 조사되었다. 각 실험조건마다 24-well plate의 상부에 제작한 마스크를 고정하여, 단일 well에만 LED가 조사되도록 하였다. 24-well plate 하부에는 포토다이오드 센서(PD300-MS; Ophir Optronics Solutions, Jerusalem, Israel)를 설치하여 마스크를 통과한 광량을 측정하고, 세포 시료에 조사하는 모든 LED 모듈의 광량을 일정하게 하였다. 실험장치는 이산화탄소 세포배양기(Forma 371; Thermo Fisher Scientific, MA, USA) 내에 설치하여 실험 중 일정한 환경이 유지되도록 하였다[그림 1(a)]. LED 조명 모듈의 출력 중심파장, 출력 스펙트럼은 스펙트로미터(USB4000; OceanInsight, FL, USA)를 사용하여 측정하였다[그림 1(b)]. 모든 실험과정에서 LED의 총 에너지 양은 3–10 J/cm2 범위에서 조사하였다.

Figure 1. Representative picture of the experimental setup and emission spectra of light-emitting diodes (LEDs). (a) LEDs were irradiated to the 24-well plate from the top and a single-well-shaped mask was fixed on the top surface of the well plate to prevent LED light from being irradiated to adjacent wells. The power of LED light transmitted through the mask was measured with a photodiode sensor to derive the amount of light energy irradiated to the sample. (b) Normalized spectra of LED light sources.

2.3. 세포 생존률 측정

세포 생존률은 EZ-Cytox kit (DaeilLab, Seoul, Korea)를 사용하여 분석하였다. 간단하게는, 살아있는 세포의 탈수소 효소(dehydrogenase)로 water soluble tetrazolium salt (WST)를 반응시켜, 오렌지 색의 수용성 포르마잔(formazan)이 생성되는 양을 흡광도로 측정하여 세포의 생존률을 측정하였다. 우선, HCE 세포를 24-well plate에(5 × 104 cells/well) 시딩(seeding)하고 24시간 동안 배양시켜 완전히 부착된 것을 확인한 다음, HCE 세포에 적색(λ = 623, 660 nm) 및 적외선 LED (λ = 740, 850, 940 nm)를 5 J/cm2, 10 J/cm2의 에너지로 조사하고, 24시간 동안 37 ℃, 5% CO2 습윤 배양기에서 추가로 배양하였다. 다음날, 배양액에 각 well 당 EZ-Cytox 용액을 100 µL씩 첨가한 뒤, 4시간 동안 추가로 배양(incubation)하였다. 흡광도를 측정하기 전, 1분 정도 부드럽게 흔든 후 microplate reader (Epoch; BioTek, VT, USA)를 이용하여 450 nm에서 흡광도를 측정하였다. 세포 생존률은 광 조사를 하지 않은 그룹의 흡광도 수치를 기준으로 한 상대 비율 값으로 계산하였다.

2.4. 세포이동 측정

HCE 세포를 6-well plate에 2.5 × 105 cells로 분주하여 24시간 동안 배양한 다음, 다음날 멸균된 200 μl 피펫 팁을 수직으로 반듯이 세워 단일층으로 자란 세포면 중앙에 한 줄로 균일하게 세로 방향으로 긁어낸다. 긁어내는 과정에서 분리된 세포조각(cell debris)은 배지 제거를 통해 조심스럽게 제거하고, 불필요하게 떨어진 나머지 세포들 또한 인산완충생리식염수(phosphate-buffered saline)를 이용하여 세척한 뒤, 배양배지로 교환한다. 이때, 스크래치(scratch)된 부위의 세포를 Olympus CKX53 현미경(Olympus, Tokyo, Japan)을 통해 40× 배율에서 관찰하고 카메라를 이용하여 사진 촬영한다. 이후, 스크래치된 세포는 2.2절에서 제시된 바와 같은 광 조사 조건에 노출시킨 후 24시간 동안 추가 배양(37 °C, 5% CO2)하고, 세포이동이 진행된 이미지를 상기와 같은 조건으로 사진으로 촬영한다.

2.5. Real-time PCR

각 파장별 광 조사가 세포이동의 어떠한 분자 발현에 영향을 미치는지를 조사하고자, real-time polymerase chain reaction (PCR)을 수행하여 관련 유전자의 발현을 분석하였다. 6-well에 배양된 세포에 상기의 세포이동 실험을 수행한 후, RNeasy kit (Qiagen, MD, USA)를 이용하여 mRNA를 분리하였다. 분리된 mRNA 1 µg을 PrimeScriptTM RT Reagent Kit (Takara Biotechnology, Tokyo, Japan)와 제조사에서 제시한 프로토콜에 따라 cDNA를 합성하였다. 합성된 cDNA를 대상으로 Power SYBR Green PCR Master Mix (Applied Biosystems, CA, USA) 시약과 혼합하여 QuantStudio 3 real-time PCR system (Applied Biosystems, CA, USA) 기기를 이용하여 real-time PCR을 수행하였다. 분석 결과는 2∆∆CT method로 상대적인 발현양으로 계산되었으며, 가사유전자(housekeeping gene)로서의 glyceraldehyde 3-phosphate dehydrogenase (GAPDH)의 발현을 대조군으로 사용하여 정규화(normalization)를 수행하였다. 타깃 유전자에 대한 프라이머(primer) 정보는 표 1에 나타냈다.

Table 1 . Primer name, sequence, and target gene used in the present study.

NameSequence (5' → 3')Target Gene
hGAPDH_F
hGAPDH_R
accccttcattgacctcaac
cttgacggtgccatggaatt
GAPDH
hIL-1α_F
hIL-1α_R
ggtagtagcaaccaacggga
cttcatcttgggcagtcaca
IL-1α
hTGF-β1_F
hTGF-β1_R
gggactatccacctgcaaga
cggagctctgatgtgttgac
TGF-β
hIGF-2_F
hIGF-2_R
caccctccagttcgtctgtg
ttgggtgggtagagcaatca
IGF-2
hFGF-1_F
hFGF-1_R
agcccacagagcctgaattt
caggaaggacaaaagggagc
FGF-1
hCOL3A1_F
hCOL3A1_R
hMMP-2_F
hMMP-2_R
cctccaactgctcctactcg
tcgaagcctctgtgtccttt
gctggagaaccaaagtctga
cagtgccctcttgagacagt
Col3A1
MMP2


2.6. 통계 처리

본 실험의 데이터는 GraphPad Prism 5 (GraphPad, CA, USA)를 사용하여 분석되었으며, 실험결과는 독립적인 3반복 실험의 평균 ± 표준편차로 나타냈다. 그룹 간의 차이는 unpaired two tailed t-test 방법을 이용하여 유의성을 분석하였으며, P < 0.05이 통계적 유의성을 가지는 것으로 정의되었다.

III. 결 과

3.1. 세포 생존률 평가

HCE 세포에 대한 적색 및 근적외선 LED의 세포 독성과 실험에 사용될 총 에너지량을 결정하기 위해 MTT assay를 수행하였다. HCE 세포에 적색(λ = 623, 660 nm) 및 적외선 LED (λ = 740, 850, 940 nm)를 5 J/cm2, 10 J/cm2의 에너지로 조사한 결과, 모든 군에서 독성이 나타나지 않아 세포 생존율에 큰 영향을 나타내지 않음을 확인하였다(그림 2). 이후, 모든 실험은 세포 독성이 나타나지 않은 광 조사 조건에서 진행하였다. 광조사가 실시된 그룹들 전반적으로 대조군(비 광조사군)에 비해 세포 생존율(cell viability)이 높아진 것이 관찰되었으며, 이러한 경향은 세포 증식에 적외선을 포함한 근적외선 파장 광조사가 미친 영향이라고 생각된다[13].

Figure 2. Cell viability measurement by red light-emitting diode (LED) and infrared LED irradiation with fluences of (a) 5 J/cm2 and (b) 10 J/cm2. All groups showed no cytotoxicity compared to the control group. Every assay was performed 3 times and the results are expressed as mean ± standard deviation (SD). An unpaired two tailed t-test was used for comparisons between two means.

3.2. 세포이동

각 파장의 광조사에 따른 HCE 세포의 상처 치유(wound healing) 영향을 조사하고자, 단일층(monolayer)으로 준비된 세포에 스크래치를 만들어 그 사이를 세포가 이동(migration)하면서 채워 나가는 효과를 관찰하였다. 세포의 스크래치는 모두 균일하게 형성하였으며[그림 3(a), 0 h], 각 파장 별로 단위면적당 10 J/cm2의 광 조사 후 세포이동을 관찰한 결과 그림 3(a) (48 h)에서 보이듯 623 nm의 광 조사 시 스크래치 간격 사이로 세포이동이 촉진됨으로 인해 그 폭이 대조군에 비해 더 좁아진 것을 확인할 수 있었다. 623 nm 파장의 세포이동에 대한 영향을 추가로 확인하기 위해서 광 조사를 에너지 별로(3 J/cm2, 5 J/cm2, 10 J/cm2) 실시하고 경과시간 별로(24 h, 48 h) 분석한 결과, 그림 3(b)와 같이 623 nm 광조사 그룹의 세포이동 효과가 대조군인 비조사군에 비해 증가하는 것이 관찰되었으며, 이를 상처 치유 면적으로 계산하여 본 결과 그림 3(c)에서 보이듯 623 nm의 3 J/cm2 조사군에서 가장 높은 상처 치유 효과를 관찰할 수 있었다.

Figure 3. Images of cell migration assay of human corneal epithelial (HCE) cells. HCE cells were inoculated into 6 wells at 2.5 × 105 cells per well. The next day, cell monolayers were scratched using a sterile 200 μL pipette tip followed by the indicated LED irradiation. (a) Scratched cells were exposed to 623, 660, 740, 850, and 940 nm LED light with an intensity of 33.3 mW/cm2 and total energy of 10 J/cm2. (b) Scratched cells were exposed to 623 nm LED light with an intensity of 0, 3, 5, and 10 J/cm2. Cell migration was observed using an inverted microscope (Olympus CKX53; Olympus) and a digital camera at 0, 24, and 48 hours after scratching. (c) Cell wound area at 24 and 48 hours after wounding [(healing area/wounding area) × 100%].

3.3. Real-time PCR

HCE 세포의 세포이동에 있어 623 nm의 LED가 어떠한 분자 발현에 영향을 미치는지를 분석하고자, 세포이동에 관련된 유전자들의 발현을 real-time PCR을 수행하여 분석하였다. IL-1α, TGF-β, IGF2, fibroblast growth factor 1 (FGF-1), Col3A1, matrix metalloproteinase-2 (MMP2) 유전자의 발현을 대조군인 비조사군과 비교한 결과, FGF-1과 MMP2유전자의 발현이 유의적으로 증가함을 관찰하였으며, IGF-2유전자의 경우 통계적으로 유의적이진 않지만, 대조군에 비해 광조사군에서 증가하는 경향을 확인할 수 있었다(그림 4).

Figure 4. Effect of 623 nm light-emitting diode (LED) irradiation on the expression of migration-related genes in human corneal epithelial (HCE) cells. The expression of the target gene was analyzed by real-time polymerase chain reaction (PCR) in HCE cells. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the endogenous control gene for the normalization of mRNA expression. Relative expression of (a) IL-1a, (b) TGF-b, (c) IGF-2, (d) FGF-1, (e) Col2A1, and (f) MMP-2. The data presented are the mean ± standard deviation (SD) of three independent experiments. P < 0.05 compared with the control (non-irradiation group).

FGF-1 유전자는 산성 섬유아세포 성장 인자로서, 사람 또는 소의 각막 내피세포의 상처 치유를 촉진시키는 역할을 하는 것으로 알려져 있다[15,16]. 본 연구에서 623 nm 광 조사 시, 세포이동이 촉진되는 결과를 관찰할 수 있었으며 이때 FGF-1의 발현이 대조군(1.0 ± 0.16)에 비해 광조사군(1.59 ± 0.25)에서 50% 이상 증가됨을 확인하였다(P = 0.02). MMP2 유전자는 세포 외 기질 분해 기전에 중요한 기능을 하는 유전자로서, MMP2의 발현이 각막 상처치유 초기단계에서 기질 회복(stromal repair)에 역할을 하는 것으로 알려져 있으며[17], 상처 치유 중 눈물 및 각막 조직, 안구 건조증과 같은 안구 표면 질환 및 원추 각막과 같은 기질 장애에 존재하는 것으로 보고되었다[18]. 본 연구결과에서도 이와 비슷하게 세포이동이 촉진되는 것이 확인된 광조사군에서 MMP2의 발현이 대조군에 비해 유의적으로 증가(1.0 ± 0.44 vs. 1.88 ± 0.23, P = 0.04)함을 확인하였다. 뿐만 아니라, IGF-2 유전자의 경우 insulin-like growth factor 2 유전자로서 쥐(rat)의 각막 내피세포의 상처유발 시 세포의 성장을 촉진하는 것으로 알려져 있으며[19], 토끼의 각막 상피세포의 이동 또한 증가하는 것으로 보고된 바 있다[20]. 본 연구결과에서 IGF-2의 발현은, 비록 통계적으로 유의성이 드러나지 않았지만, 대조군에 비해 광조사군에서 증가하는 양상을 관찰할 수 있었다(1.0 ± 0.22 vs. 9.28 ± 6.65, P < 0.05).

이 외에 세포손상 및 사멸과 관련된 유전자인 IL-1α, 정상적인 눈물에 존재한다고 알려진 TGF-β, 콜라겐의 단량체 유형으로 일반적으로 조직 상처치유와 상관관계가 있다고 알려진 Col3A1의 발현은 광 조사와 유의미한 상관관계가 없음을 관찰하였다. 따라서, HCE 세포에서 623 nm 광조사에 따른 세포이동은 FGF-1, MMP2 두 유전자에 의한 것으로 짐작된다.

IV. 결 론

본 연구에서는 각막상피세포의 상처 치유에 광조사가 미치는 영향을 알아보기 위해 적색(λ = 623, 660 nm) 및 적외선 LED (λ = 740, 850, 940 nm)를 사용하여 세포 레벨에서의 PBM 효과를 분석하였다. LED 광조사에 따른 세포독성이 나타나지 않음을 확인하고, 각 파장별로 LED 광원을 각막상피세포에 조사하여 세포이동 결과를 분석한 결과 623 nm LED 광조사군에서 가장 세포이동이 촉진됨을 확인하였다. 623 nm LED 광조사군에 대해 real-time PCR 분석 결과, 상처치유를 촉진하는 FGF-1과 MMP2의 유전자 발현이 대조군에 비해 50% 이상 증가함을 확인하였으며, IGF-2 유전자의 경우 비록 통계적으로 유의성이 드러나지 않았지만, 대조군에 비해 증가하는 경향을 관찰할 수 있었다. 이러한 연구결과로부터 623 nm LED의 각막상피세포에 대한 PBM 효과로서 세포이동이 촉진되고 결과적으로 각막상피세포의 상처치유 개선에 활용할 수 있는 가능성을 확인하였다. 본 연구 결과는 향후 각막 상피 세포에 대한 물리적 또는 화학적 손상으로 인한 상처 치유나 안과 수술 후 빠른 회복을 위한 수단으로 적색광에 의한 PBM 효과를 이용하는 광치료기기를 개발하는 데에 활용할 수 있을 것으로 기대한다.

감사의 글

저자들은 이진경, 김홍빈 연구원의 세포실험 지원에 대해 감사를 표한다.

재정지원

이 논문은 2021학년도 부경대학교의 지원을 받아 수행된 연구임(202126870001).

이해상충

저자들은 본 논문과 관련된 어떠한 이해충돌 사항도 없었음을 밝힌다.

데이터 가용성

본 연구의 결과 분석 및 생성된 데이터는 모두 본 논문 내 명시되어 있으며 공공의 이용이 가능하다. 데이터에 접근하거나 사용하고자 하는 이는 저자에게 타당한 이유를 밝히고 허가를 득해 사용 가능하다.

Fig 1.

Figure 1.Representative picture of the experimental setup and emission spectra of light-emitting diodes (LEDs). (a) LEDs were irradiated to the 24-well plate from the top and a single-well-shaped mask was fixed on the top surface of the well plate to prevent LED light from being irradiated to adjacent wells. The power of LED light transmitted through the mask was measured with a photodiode sensor to derive the amount of light energy irradiated to the sample. (b) Normalized spectra of LED light sources.
Korean Journal of Optics and Photonics 2023; 34: 45-52https://doi.org/10.3807/KJOP.2023.34.2.045

Fig 2.

Figure 2.Cell viability measurement by red light-emitting diode (LED) and infrared LED irradiation with fluences of (a) 5 J/cm2 and (b) 10 J/cm2. All groups showed no cytotoxicity compared to the control group. Every assay was performed 3 times and the results are expressed as mean ± standard deviation (SD). An unpaired two tailed t-test was used for comparisons between two means.
Korean Journal of Optics and Photonics 2023; 34: 45-52https://doi.org/10.3807/KJOP.2023.34.2.045

Fig 3.

Figure 3.Images of cell migration assay of human corneal epithelial (HCE) cells. HCE cells were inoculated into 6 wells at 2.5 × 105 cells per well. The next day, cell monolayers were scratched using a sterile 200 μL pipette tip followed by the indicated LED irradiation. (a) Scratched cells were exposed to 623, 660, 740, 850, and 940 nm LED light with an intensity of 33.3 mW/cm2 and total energy of 10 J/cm2. (b) Scratched cells were exposed to 623 nm LED light with an intensity of 0, 3, 5, and 10 J/cm2. Cell migration was observed using an inverted microscope (Olympus CKX53; Olympus) and a digital camera at 0, 24, and 48 hours after scratching. (c) Cell wound area at 24 and 48 hours after wounding [(healing area/wounding area) × 100%].
Korean Journal of Optics and Photonics 2023; 34: 45-52https://doi.org/10.3807/KJOP.2023.34.2.045

Fig 4.

Figure 4.Effect of 623 nm light-emitting diode (LED) irradiation on the expression of migration-related genes in human corneal epithelial (HCE) cells. The expression of the target gene was analyzed by real-time polymerase chain reaction (PCR) in HCE cells. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the endogenous control gene for the normalization of mRNA expression. Relative expression of (a) IL-1a, (b) TGF-b, (c) IGF-2, (d) FGF-1, (e) Col2A1, and (f) MMP-2. The data presented are the mean ± standard deviation (SD) of three independent experiments. P < 0.05 compared with the control (non-irradiation group).
Korean Journal of Optics and Photonics 2023; 34: 45-52https://doi.org/10.3807/KJOP.2023.34.2.045

Table 1 Primer name, sequence, and target gene used in the present study

NameSequence (5' → 3')Target Gene
hGAPDH_F
hGAPDH_R
accccttcattgacctcaac
cttgacggtgccatggaatt
GAPDH
hIL-1α_F
hIL-1α_R
ggtagtagcaaccaacggga
cttcatcttgggcagtcaca
IL-1α
hTGF-β1_F
hTGF-β1_R
gggactatccacctgcaaga
cggagctctgatgtgttgac
TGF-β
hIGF-2_F
hIGF-2_R
caccctccagttcgtctgtg
ttgggtgggtagagcaatca
IGF-2
hFGF-1_F
hFGF-1_R
agcccacagagcctgaattt
caggaaggacaaaagggagc
FGF-1
hCOL3A1_F
hCOL3A1_R
hMMP-2_F
hMMP-2_R
cctccaactgctcctactcg
tcgaagcctctgtgtccttt
gctggagaaccaaagtctga
cagtgccctcttgagacagt
Col3A1
MMP2

References

  1. N. C. Delic, J. G. Lyons, N. D. Girolamo, and G. M. Halliday, “Damaging effects of ultraviolet radiation on the cornea,” Photochem. Photobiol. 93, 920-929 (2017).
    Pubmed CrossRef
  2. M. D. Wagoner, “Chemical injuries of the eye: Current concepts in pathophysiology and therapy,” Surv. Ophthalmol. 41, 275-313 (1997).
    Pubmed CrossRef
  3. K. Watanabe, S. Nakagawa, and T. Nishida, “Stimulatory effects of fibronectin and EGF on migration of corneal epithelial cells,” Investig. Ophthalmol. Vis. Sci. 28, 205-211 (1987).
  4. S. E. Wilson, L. Chen, R. R. Mohan, Q. Liang, and J. Liu, “Expression of HGF, KGF, EGF and receptor messenger RNAs following corneal epithelial wounding,” Exp. Eye Res. 68, 377-397 (1999).
    Pubmed CrossRef
  5. X. Wang, S. Zhang, M. Dong, Y. Li, Q. Zhou, and L. Yang, “The proinflammatory cytokines IL‐1β and TNF‐α modulate corneal epithelial wound healing through p16Ink4a suppressing STAT3 activity,” J. Cell. Physiol. 235, 10081-10093 (2020).
    Pubmed CrossRef
  6. J. Imanishi, K. Kamiyama, I. Iguchi, M. Kita, C. Sotozono, and S. Kinoshita, “Growth factors: importance in wound healing and maintenance of transparency of the cornea,” Prog. Retin. Eye Res. 19, 113-129 (2000).
    Pubmed CrossRef
  7. L. F. de Freitas and M. R. Hamblin, “Proposed mechanisms of photobiomodulation or low-level light therapy,” IEEE J. Sel. Top. Quantum Electron. 22, 348-364 (2016).
    Pubmed KoreaMed CrossRef
  8. Y.-Y. Huang, A. C.-H. Chen, J. D. Carroll, and M. R. Hamblin, “Biphasic dose response in low level light therapy,” Dose-response 7, 358-383 (2009).
    Pubmed KoreaMed CrossRef
  9. R. M. da S. Campos, A. R. Dâmaso, D. C. L. Masquio, A. E. Aquino Jr., M. Sene-Fiorese, F. O. Duarte, L. Tock, N. A. Parizotto, and V. S. Bagnato, “Low-level laser therapy (LLLT) associated with aerobic plus resistance training to improve inflammatory biomarkers in obese adults,” Lasers Med. Sci. 30, 1553-1563 (2015).
    Pubmed CrossRef
  10. D. P. Kuffler, “Photobiomodulation in promoting wound healing: A review,” Regen. Med. 11, 107-122 (2016).
    Pubmed CrossRef
  11. B. Tashbayev, M. Yazdani, R. Arita, F. Fineide, and T. P. Utheim, “Intense pulsed light treatment in meibomian gland dysfunction: A concise review,” Ocular Surf. 18, 583-594 (2020).
    Pubmed CrossRef
  12. S. Yan and Y. Wu, “Efficacy and safety of intense pulsed light therapy for dry eye caused by meibomian gland dysfunction: A randomised trial,” Ann. Palliat. Med. 10, 7857-7865 (2021).
    Pubmed CrossRef
  13. C. Núñez-Álvarez and N. N. Osborne, “Enhancement of corneal epithelium cell survival, proliferation and migration by red light: Relevance to corneal wound healing,” Exp. Eye Res. 180, 231-241 (2019).
    Pubmed CrossRef
  14. Y.-H. Rhee, K. J. Cho, J.-C. Ahn, and P.-S. Chung, “Effect of photobiomodulation on wound healing of the corneal epithelium through Rho-GTPase,” Med. Lasers 6, 67-76 (2017).
    CrossRef
  15. A. Thalmann-Goetsch, K. Engelmann, and J. Bednarz, “Comparative study on the effects of different growth factors on migration of bovine corneal endothelial cells during wound healing,” Acta Ophthalmol. Scand. 75, 490-495 (1997).
    Pubmed CrossRef
  16. D. Eveleth, S. Pizzuto, J. Weant, J. Jenkins-Eveleth, and R. A. Bradshaw, “Proliferation of human corneal endothelia in organ culture stimulated by wounding and the engineered human fibroblast growth factor 1 derivative TTHX1114,” J. Ocul. Pharmacol. Ther. 36, 686-696 (2020).
    Pubmed KoreaMed CrossRef
  17. B. Mulholland, S. J. Tuft, and P. T. Khaw, “Matrix metalloproteinase distribution during early corneal wound healing,” Eye 19, 584-588 (2005).
    Pubmed CrossRef
  18. M. P. Caley, V. L. Martins, and E. A. O'Toole, “Metalloproteinases and wound healing,” Adv. Wound Care 4, 225-234 (2015).
    Pubmed KoreaMed CrossRef
  19. S. R. Gordon, D. R. Reaume, and T. R. Perkins, “Insulin and IGF-2 support rat corneal endothelial cell growth and wound repair in the organ cultured tissue,” Growth Factors 38, 269-281 (2020).
    Pubmed CrossRef
  20. M. Nakamura, T. I. Chikama, and T. Nishida, “Characterization of insulin-like growth factor-1 receptors in rabbit corneal epithelial cells,” Exp. Eye Res. 70, 199-204 (2000).
    Pubmed CrossRef

저널정보

Optical Society of Korea

February 2024
Vol.35 No.1

pISSN 1225-6285
eISSN 2287-321X

Title: Korean Journal of Optics and Photonics
Abbreviation: Korean J. Opt. Photon.

Share this article on :

  • line